Journal: Clinical Cancer Research

Article Title: High Expression of a New Marker PCA-1 in Human Prostate Carcinoma

doi: 10.1158/1078-0432.ccr-05-0195

Figure Lengend Snippet: Fig. 6. Real-time PCR analysis of pca-1mRNA expression in normal human tissues. The tissue-specific expression of pca-1mRNA was determined by an SYBR Green I ^ based quantitative PCR assay in normalized cDNA samples derived from15 different human tissues.The expression levels of PCA-1transcript in the human tissues were normalized for the expression levels of the b-actin transcripts in the same cDNAs.1, brain; 2, thymus; 3, heart; 4, lung; 5, liver; 6, spleen; 7, pancreas; 8, smallintestine; 9, colon;10, kidney;11, prostate;12, testis;13, ovary;14, peripheral blood leukocyte;15, placenta. Columns, averages of three independent measurements per tissue.

Article Snippet: The 5V-RACE (rapid amplification of cDNA ends) method was done to isolate the 5V-end portion of the newly identified cDNAs (activator protein, CCATCCTAATACGACTCACTATAGGGC; PCA-1-RACE, CTGTTCCCACAGTAGACC) using the human thymus Marathon-ready cDNA library (BD Clontech, Palo Alto, CA).

Techniques: Real-time Polymerase Chain Reaction, Expressing, SYBR Green Assay, Derivative Assay

Journal: Nucleic Acids Research

Article Title: Coordinated glucocorticoid receptor and MAFB action induces tolerogenesis and epigenome remodeling in dendritic cells

doi: 10.1093/nar/gkab1182

Figure Lengend Snippet: Phenotypic profiling of dexamethasone-mediated tolerogenic dendritic cells. ( A ) Schematic representation of the experimental approach, comparing dendritic cell (DC) with tolerogenic dendritic cell (tolDC) differentiation. ( B ) DC and tolDC were cocultured with CD8+ cells for 5 days. The final CFSE signal of CD8 + cells is shown (left panel). CD8+ with only CD3/CD28 T-activator beads (C+) or alone (C–) are also shown. In the right panel, the average proliferation is shown (mean ± standard error of the mean (SEM)) ( n = 4). ( C ) IL-10, TNFα, IL-12p70 and IL1-β production of DC and tolDC, after 5 days of differentiation and 24 h of LPS (10 ng/μl) and IFNg (20 ng/μl) stimuli. P-values of paired t-tests are shown ( n = 4) (ns P > 0.05, * P < 0.05). ( D ) Box-plots of CD80, CD83, CD86 and HLA-DR surface expression (Median Fluorescence Intensity) in DCs and tolDCs in steady-state or stimulated with LPS (10 ng/μl) and IFNg (20 ng/μl) ( n = 6) (ns P > 0.05, ** P < 0.01, *** P ≤ 0.001). ( E ) Gene expression heatmap of differentially expressed genes comparing tolDCs with DCs and also displaying the gene expression values of the precursor cell type (MO) (logFC > 0.5, FDR < 0.05). Scaled fluorescence values of expression arrays are shown, ranging from −2 (lower gene expression, green) to +2 (higher gene expression, orange) ( n = 3). ( F ) Gene ontology (GO) over-representation of GO Biological Process categories. Fold change of tolDC induced genes over background and -log10(FDR) of Fisher's exact tests are shown. ( G ) Discriminant regulon expression analysis (DoRothEA) of tolDC compared with DC. Only transcription factors with FDR <0.05 are shown. NES and logFC of transcription factor expression are depicted. ( H ) T -distributed stochastic neighbor embedding ( t -SNE) plot of the aggregated and batch-corrected gene expression data from our study (MO, DC and tolDC) and two additional public datasets (GSE40484 (moMAC, moDC, cDC2, CM (classical MOs) and NCM (non-classical MOs) and GSE99056 (M-MAC (M2 macrophages) and GM-MAC (M1 macrophages)). The four different groups obtained using k -means clustering are represented with grey ellipses of multivariate t-distributions.

Article Snippet: Allogenic CD8 + were isolated by negative selection using Dynabeads Untouched Human CD8 T Cells Kit (Invitrogen) and labeled with carboxyfluorescein succinimidyl ester (CFSE) CellTrace™ (Invitrogen), in accordance with the manufacturer's instructions.

Techniques: Expressing, Fluorescence

Journal: Nucleic Acids Research

Article Title: Coordinated glucocorticoid receptor and MAFB action induces tolerogenesis and epigenome remodeling in dendritic cells

doi: 10.1093/nar/gkab1182

Figure Lengend Snippet: Effects of MAFB knockdown during tolDC differentiation. ( A ) Volcano plot comparing tolDCs treated with control siRNA (siCTL) and MAFB siRNA (siMAFB). Dashed lines indicate significance thresholds (FDR < 0.05, absolute logFC > 0.5) ( n = 4). tolDC-induced and tolDC-repressed genes are shown in blue and orange, respectively. ( B ) Gene set enrichment analysis (GSEA) of tolDCs (siCTL) versus tolDCs (siMAFB), using tolDC-induced and tolDC-repressed gene sets. The running enrichment score is represented and the normalized enrichment score (NES) is shown above (FDR < 0.01). ( C ) DNA methylation heatmap of previously obtained differentially methylated CpGs (C1-CpGs and C2-CpGs) in tolDCs (siCTL) and tolDCs (siMAFB). Scaled β-values are shown (lower DNA methylation levels in blue and higher methylation levels in red). On the right side, violin plots of Cluster 1 (C1) and Cluster 2 (C2) depict β-values ( n = 4) (ns P > 0.05, *** P ≤ 0.001). ( D ) Methylated CpG set enrichment analysis (mCSEA) of tolDCs (siCTL) versus tolDCs (siMAFB), using MAFB-only CpGs, GR/MAFB CpGs and GR-only CpGs as CpG-sets (depending on the overlap of CpGs with GR or MAFB peaks). The running enrichment score is represented and the normalized enrichment score (NES) and FDR are shown above. ( E ) Box-plots of median fluorescence intensity (MFI) of CD14, CD16, CD163 and CD1a flow cytometry data from DCs (siCTL), tolDCs (siCTL) and tolDCs (siMAFB) ( n = 7) (ns P > 0.05, * P < 0.05, ** P ≤ 0.01). ( F ) Box-plots of supernatant concentration from DCs (siCTL), tolDCs (siCTL) and tolDCs (siMAFB) ( n = 7) of IL-10 in steady-state and stimulated conditions (LPS 10 ng/μl and IFNγ 20 ng/μl) and IL-12p70 and TNFα under stimulated conditions (pg/mL). TNFα and IL-12p70 in steady state were not detected. (ns P > 0.05, * P < 0.05, ** P ≤ 0.01) ( G ) DC (siCTL), tolDC (siCTL) and tolDC (siMAFB) were cocultured with CD8 + cells for 5 days ( n = 4). The final CFSE signal of CD8+ cells is shown (left panel). CD8+ with only CD3/CD28 T-activator beads (C+) or alone (C-) are also shown. On the right panel, the average proliferation of the quadruplicate is shown (mean ± standard error of the mean (SEM)) (** P ≤ 0.01, *** P ≤ 0.001).

Article Snippet: Allogenic CD8 + were isolated by negative selection using Dynabeads Untouched Human CD8 T Cells Kit (Invitrogen) and labeled with carboxyfluorescein succinimidyl ester (CFSE) CellTrace™ (Invitrogen), in accordance with the manufacturer's instructions.

Techniques: DNA Methylation Assay, Methylation, Fluorescence, Flow Cytometry, Concentration Assay